Question 34 - Chemical and Physical Foundations of Biological Systems Practice Test for the MCAT

Using the attachment, how many amino acids would be located on the polypeptide chain made from the sequence ATTATGCGTCAATGAATAAGACTG?

DNA (deoxyribonucleic acid) is the information-storing biomolecule of the cell. The process by which the information stored in DNA can be converted into proteins can be broken down into three subprocesses:

Replication: In this process, a parent DNA strand is paired with its complementary strand. Adenine is paired with thymine, cytosine is paired with guanine, and vice-versa. In this way the information stored in DNA is preserved.
Transcription: In this process, DNA is separated and the complementary strand is copied into mRNA. Adenine is paired with uracil, cytosine is paired with guanine, and vice-versa. Translation: In this process, tRNA recognizes sequences of three bases in RNA called codons and transfers an amino acid into the growing protein chain that starts with the codon that codes for methionine. The codons are shown in the image below and are read starting from the center:

34-35-d-n-a-chart.png

Retrieved from: https://opentextbc.ca/biology2eopenstax/chapter/the-genetic-code/

Previous

Create a FREE profile to save your progress and scores!

Create a Profile

Already signed up? Sign in

Unlock all features!

  • Exam simulation mode
  • Printer friendly downloads
  • Ad-free studying
  • Money-back guarantee
Upgrade to Premium
MathHelp
Need MCAT Math Test Prep?
If you are serious about getting a great score on your MCAT Math test, try our recommended Math Prep Course.